Informace o publikaci
Method of diagnosis of colorectal cancer
| Autoři | |
|---|---|
| Rok publikování | 2020 |
| Druh | Patent |
| Fakulta / Pracoviště MU | |
| Vydavatel | European Patent Office |
| Stát vydání | Německo |
| Číslo patentu | EP3431609B1 |
| www | odkaz na stránku Evropského patentového úřadu |
| Popis | The present invention relates to a method of diagnosing and prognosing colorectal cancer using piRNA-hsa-5937, having the sequence TCCCTGGTGGTCTAGTGGTTAGGATTCGGCA (SEQ ID NO. 1), as a biomarker. The biomarker can be combined with other piRNAs or miRNAs. The resulting method uses a body fluid as the input, and therefore is non-invasive, has a high sensitivity and specificity even in very early stages of the disease, and is cost-effective. |
| Související projekty: |